Top » Catalog » E » BY9671

$18.00

BY9671
[BY9671]

BY9671
hg38 Position: ChrY:8417526..8417526
Ancestral: G
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below L19 > Z5009
Forward Primer: BY9671_F ATTCAGTGGGATAACTTCAGGC
Reverse Primer: BY9671_R CTCAGAGAGATGTAGGTCAGCAGC
Reviews

Customers who bought this product also purchased
BY9749
BY9749
MZ151
MZ151
E Superclade Panel
E Superclade Panel
Z834
Z834
L335
L335
M78
M78
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies