Top » Catalog » E » BY9671

$18.00

BY9671
[BY9671]

BY9671
hg38 Position: ChrY:8417526..8417526
Ancestral: G
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below L19 > Z5009
Forward Primer: BY9671_F ATTCAGTGGGATAACTTCAGGC
Reverse Primer: BY9671_R CTCAGAGAGATGTAGGTCAGCAGC
Reviews

Customers who bought this product also purchased
PF2546
PF2546
Y20074
Y20074
MZ211
MZ211
MZ136
MZ136
BY9699
BY9699
BY9626
BY9626
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y10755
1 x BY8236
1 x A14083
1 x BZ1149
$72.00
Haplogroup Info
Other products
Currencies