Top » Catalog » E » BY9671

$18.00

BY9671
[BY9671]

BY9671
hg38 Position: ChrY:8417526..8417526
Ancestral: G
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below L19 > Z5009
Forward Primer: BY9671_F ATTCAGTGGGATAACTTCAGGC
Reverse Primer: BY9671_R CTCAGAGAGATGTAGGTCAGCAGC
Reviews

Customers who bought this product also purchased
Y20074
Y20074
MZ211
MZ211
PF2546
PF2546
A1152
A1152
Z36193
Z36193
Z5009
Z5009
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY7100
1 x BY6276
$36.00
Haplogroup Info
Other products
Currencies