Top » Catalog » E » A22949

$18.00

A22949
[A22949]

A22949
hg38 Position: ChrY:19824383..19824383
Ancestral: G
Derived: A
Reference: Igor Schein (2018)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1b2b1a1
Comments: Downstream Y18621
Forward Primer: A22949_F TTTCCCCTGAAAAACAGCAC
Reverse Primer: A22949_R TTTGTGGCAAATGTGAATGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A8458
$18.00
Haplogroup Info
Other products
Currencies