Top » Catalog » E » BY4477

$18.00

BY4477
[BY4477]

BY4477
hg38 Position: ChrY:15915203..15915203
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY4477_F CATACAATTGGAAGGAGTGTAGAAG
Reverse Primer: BY4477_R ACCAACATAATCCATATGCAAATATG
Reviews

Customers who bought this product also purchased
BY4471
BY4471
BY4476
BY4476
BY4475
BY4475
BY4474
BY4474
BY4473
BY4473
A19255
A19255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies