Top » Catalog » E » A23761

$18.00

A23761
[A23761]

A23761
hg38 Position: ChrY:7043689..7043689
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2018)
ISOGG Haplogroup: E
Comments: Below V13/BY3880
Forward Primer: A23761_F TACTGCCTAAGCCCACAAGG
Reverse Primer: A23761_R TTCCCAGGAAACACAGCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH2350
1 x A22591
1 x A15508
1 x Y19107
1 x A7138
1 x A11791
1 x FGC4517
$126.00
Haplogroup Info
Other products
Currencies