Top » Catalog » E » A23766

$18.00

A23766
[A23766]

A23766
hg38 Position: ChrY:8615379..8615379
Ancestral: C
Derived: G
Reference: Bruce Cockburn (2018)
ISOGG Haplogroup: E
Comments: Below V13/BY3880
Forward Primer: A23766_F GCCAGTCCAAGGTGTGG
Reverse Primer: A23766_R TGGTAGAAGCAGAACCGTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY6605
1 x BY176167
1 x BY5894
1 x A18013
$72.00
Haplogroup Info
Other products
Currencies