Top » Catalog » E » A23779

$18.00

A23779
[A23779]

A23779
hg38 Position: ChrY:19485552..19485552
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2018)
ISOGG Haplogroup: E
Comments: Below V13/BY3880
Forward Primer: A23779_F TCACACTAACCCTCCCAAGG
Reverse Primer: A23779_R TGTGTCCATCAGGAATACTAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18233
1 x A10927
1 x BZ1768
1 x BZ616
1 x MF669
1 x A13520
1 x BZ1353
1 x BZ1843
1 x A19079
$162.00
Haplogroup Info
Other products
Currencies