Top » Catalog » E » A2192

$18.00

A2192
[A2192]

A2192
hg38 Position: ChrY:3043285..3043285
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > CTS5856
Forward Primer: A2192_F ATGGGCTACGACAAGAATGC
Reverse Primer: A2192_R ACAGGATCTCACTATGTGGTCTAGG
Reviews

Customers who bought this product also purchased
A160
A160
BY6335
BY6335
Y145455
Y145455
Z5017
Z5017
S7461
S7461
Z16663
Z16663
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies