Top » Catalog » G » CTS6369

$18.00

CTS6369
[CTS6369]

CTS6369
hg38 Position: ChrY:14742921..14742921
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1a2a9~
Comments: .
Forward Primer: CTS6369_F CCTTTGATTTATGGGAAAATATCTG
Reverse Primer: CTS6369_R GAAGTAGAAGTTTGGAGAAGATAGCC
Reviews

Customers who bought this product also purchased
F720
F720
CTS4803
CTS4803
S2808
S2808
Z726
Z726
Z31328
Z31328
G2a-L497 Panel
G2a-L497 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies