Top » Catalog » G » FGC31715

$18.00

FGC31715
[FGC31715]

FGC31715
hg38 Position: ChrY:9933665..9933665
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a2b2a1a1c1a1b1a1a2
Comments: Below FGC249.
Forward Primer: FGC31715_F ACACATAACCACGACAGGCC
Reverse Primer: FGC31715_R GGCTGGAGTACAATGACATAATCAG
Reviews

Customers who bought this product also purchased
Z6028
Z6028
Z724
Z724
U1
U1
G2a-L1259 Panel
G2a-L1259 Panel
Z3428
Z3428
FGC31708
FGC31708
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1383
1 x CTS9737
1 x CTS440
$54.00
Haplogroup Info
Other products
Currencies