Top » Catalog » G » FGC681

$18.00

FGC681
[FGC681]

FGC681
hg38 Position: ChrY:8235886..8235886
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a1a1a1a1b1
Comments: .
Forward Primer: FGC681_F GTCATTAGCAAACAGGCCATAAG
Reverse Primer: FGC681_R TGCTCATTTTGTTTAATAATTACAGCC
Reviews

Customers who bought this product also purchased
FGC679
FGC679
FGC758
FGC758
FGC756
FGC756
Z16578
Z16578
Z16574
Z16574
FGC772
FGC772
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY95730
1 x BY48320
$36.00
Haplogroup Info
Other products
Currencies