Top » Catalog » G » FGC516

$18.00

FGC516
[FGC516]

FGC516
hg38 Position: ChrY:21197333..21197333
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2a1a1b1a3
Comments: .
Forward Primer: FGC516_F CTCTTTTCAGCACCATGTAAGAAC
Reverse Primer: FGC516_R AAATTCTCCAATCTTCAGCATTC
Reviews

Customers who bought this product also purchased
FGC502
FGC502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies