Top » Catalog » G » FGC31397

$18.00

FGC31397
[FGC31397]

FGC31397
hg38 Position: ChrY:7822435..7822435
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a2b2a1a1a1c1 (not listed)
Comments: Below U1. aka Z29424
Forward Primer: FGC31397_F CTAAATGATGGTGCCAGACG
Reverse Primer: FGC31397_R AGACCAAATCAAAGGCCTTATG
Reviews

Customers who bought this product also purchased
Z30778
Z30778
Z30777
Z30777
Z30780
Z30780
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21497
1 x Y4142
$36.00
Haplogroup Info
Other products
Currencies