Top » Catalog » G » BY171447

$18.00

BY171447
[BY171447]

BY171447
hg38 Position: ChrY:20973820..20973820
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: G
Comments: .
Forward Primer: BY171447_F CACCCCAAAACTCCCCAG
Reverse Primer: BY171447_R GCTAGAGAAGTGATGCAGATATGTTTAC
Reviews

Customers who bought this product also purchased
BY186165
BY186165
BY186164
BY186164
BY186163
BY186163
BY186162
BY186162
BY186160
BY186160
BY186166
BY186166
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC502
$18.00
Haplogroup Info
Other products
Currencies