Top » Catalog » G » BY186160

$18.00

BY186160
[BY186160]

BY186160
hg38 Position: ChrY:2982599..2982599
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: G
Comments: .
Forward Primer: BY186160_F AGATATTGTATGTCCCTTCCTCTG
Reverse Primer: BY186160_R GCAGATGCTAACCAAACCATC
Reviews

Customers who bought this product also purchased
BY186163
BY186163
BY186162
BY186162
BY171447
BY171447
BY186166
BY186166
BY186165
BY186165
BY186164
BY186164
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1294
1 x BY22262
$36.00
Haplogroup Info
Other products
Currencies