Top » Catalog » G » BY186166

$18.00

BY186166
[BY186166]

BY186166
hg38 Position: ChrY:17169886..17169886
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: G
Comments: .
Forward Primer: BY186166_F AATCTATTTTATGAAAATTCATATGATGG
Reverse Primer: BY186166_R GGGATCTGGGAAGAGAGGG
Reviews

Customers who bought this product also purchased
BY186160
BY186160
BY171447
BY171447
BY186165
BY186165
BY186164
BY186164
BY186163
BY186163
BY186162
BY186162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x GG067
1 x CTS9909
1 x L142.2
1 x BY21511
1 x BY186160
1 x GG140
1 x FGC34809
$126.00
Haplogroup Info
Other products
Currencies