Top » Catalog » G » BY186692

$18.00

BY186692
[BY186692]

BY186692
hg38 Position: ChrY:8669905..8669905
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: G
Comments: .
Forward Primer: BY186692_F GGAAGGCTGGCTGATACCTC
Reverse Primer: BY186692_R TGACCTCATTGCTCTCACATACTG
Reviews

Customers who bought this product also purchased
Y97776
Y97776
Z6911
Z6911
BY186711
BY186711
BY186518
BY186518
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY47211
1 x GG148
$36.00
Haplogroup Info
Other products
Currencies