Top » Catalog » G » GG265

$18.00

GG265
[GG265]

GG265
hg38 Position: ChrY:2911098..2911098
Ancestral: C
Derived: G
Reference: Oleg Balanovsky et al. (2015)
ISOGG Haplogroup: G1a2b
Comments: Below GG313
Forward Primer: GG265_F TCACTGAATCCACCCTAATCG
Reverse Primer: GG265_R CTGGCTTGTTTGGGAAATTG
Reviews

Customers who bought this product also purchased
GG264
GG264
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC58731
$18.00
Haplogroup Info
Other products
Currencies