Top » Catalog » G » FGC517

$18.00

FGC517
[FGC517]

FGC517
hg38 Position: ChrY:21361553..21361553
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2a1a1b1a3
Comments: .
Forward Primer: FGC517_F GTTGCAGTTGCAGGTCGA
Reverse Primer: FGC517_R CCTGACCTCATGATCAACCTGT
Reviews

Customers who bought this product also purchased
FGC519
FGC519
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY21510
$18.00
Haplogroup Info
Other products
Currencies