Top » Catalog » G » FGC519

$18.00

FGC519
[FGC519]

FGC519
hg38 Position: ChrY:21615952..21615952
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2a1a1b1a3a1~
Comments: .
Forward Primer: FGC519_F ATACATAACAATAGATACAGTACAGATTAGGAAG
Reverse Primer: FGC519_R CAGATTCGTAGCACAAAGTGTTAATC
Reviews

Customers who bought this product also purchased
FGC517
FGC517
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC35915
$18.00
Haplogroup Info
Other products
Currencies