Top » Catalog » G » B296

$18.00

B296
[B296]

B296
hg38 Position: ChrY:2965465..2965465
Ancestral: A
Derived: G
Reference: Estonian Genome Center (2015)
ISOGG Haplogroup: G2a1a1a2b1~
Comments: Below L293 > FGC1160
Forward Primer: B296_F GTCTGGTCTCTAACTCCTAGCCC
Reverse Primer: B296_R GCAGCCCTTGAAGATTACCC
Reviews

Customers who bought this product also purchased
Z31217
Z31217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies