Top » Catalog » G » A6095

$18.00

A6095
[A6095]

A6095
hg38 Position: ChrY:8750943..8750943
Ancestral: C
Derived: N
Reference: Alan Berezov
ISOGG Haplogroup: G2a1a (not listed)
Comments: .
Forward Primer: A6095_F CCAGCGAGACTTTGTAAGCC
Reverse Primer: A6095_R GCCTAGATGTTGTTGAGGTGTTG
Reviews

Customers who bought this product also purchased
Z7954
Z7954
Z7952
Z7952
FGC1041
FGC1041
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies