Top » Catalog » G » CTS9737

$18.00

CTS9737
[CTS9737]

CTS9737
hg38 Position: ChrY:16935750..16935750
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1b1
Comments: Downstream CTS1899. Aka Z1815
Forward Primer: CTS9737v2_F TTTTGTAGAGATAGGGTCTCATCATG
Reverse Primer: CTS9737v2_R CACACGTATACATAAAGGAAGCTGTC
Reviews

Customers who bought this product also purchased
Z30527
Z30527
Z27264
Z27264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies