Top » Catalog » G » FGC18956

$18.00

FGC18956
[FGC18956]

FGC18956
hg38 Position: ChrY:8044481..8044481
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC18956_F GCAGATGTTTTGTCTCTCATCAC
Reverse Primer: FGC18956_R TTTCTGTGGCCTACATGCTC
Reviews

Customers who bought this product also purchased
Z38859
Z38859
Z38858
Z38858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HU475
$18.00
Haplogroup Info
Other products
Currencies