Top » Catalog » G » FGC349

$18.00

FGC349
[FGC349]

FGC349
hg38 Position: ChrY:15601660..15601660
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2a1a1c1a1a1
Comments: .
Forward Primer: FGC349_F GGACGGCATAACTCTGTGGT
Reverse Primer: FGC349_R CCCCGAACTTGAATGTCTTC
Reviews

Customers who bought this product also purchased
Y88
Y88
FGC350
FGC350
FGC348
FGC348
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC7342
1 x FGC34809
1 x P222
$54.00
Haplogroup Info
Other products
Currencies