Top » Catalog » G » CTS11388

$18.00

CTS11388
[CTS11388]

CTS11388
hg38 Position: ChrY:20928482..20928482
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1c1a
Comments: Syn. with CTS11388; downstream PF3346
Forward Primer: CTS11388_F TCCAGCCTGGTTATTTCAGC
Reverse Primer: CTS11388_R GGTTATGGTTCCCTGTTTGG
Reviews

Customers who bought this product also purchased
PF7395
PF7395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies