Top » Catalog » G » M3261

$18.00

M3261
[M3261]

M3261
hg38 Position: ChrY:8258629..8258629
Ancestral: C
Derived: T
Reference: Norm Pritchett (2014)
ISOGG Haplogroup: G2a2b1a2a1
Comments: Below L30 > M3302
Forward Primer: M3261_F CAGAATTACAAGGCATGCCTC
Reverse Primer: M3261_R CAGTCTCAGCTCCATCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC58189
1 x A19505
$36.00
Haplogroup Info
Other products
Currencies