Top » Catalog » G » F1175

$18.00

F1175
[F1175]

F1175
hg38 Position: ChrY:8531156..8531156
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: G2a2b2b
Comments: Found in a hg G person. Likely a singleton.
Forward Primer: F1175_F CAGTGTTTAGGTGGGAGTACTCA
Reverse Primer: F1175_R ATGAAACAGAGGCTAGATTACAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Page108
1 x FGC489
1 x M3495
$54.00
Haplogroup Info
Other products
Currencies