Top » Catalog » G » FGC498

$18.00

FGC498
[FGC498]

FGC498
hg38 Position: ChrY:13547990..13547990
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: G2a2b2a1a1b1a3a
Comments: Found in G-L497 and R-L226 persons
Forward Primer: FGC498_F CTTCCTGCCATAGTTACCATTAGC
Reverse Primer: FGC498_R TTTTAATATGAGATTGGGTCTCACTG
Reviews

Customers who bought this product also purchased
FGC5634
FGC5634
FGC5653
FGC5653
FGC499
FGC499
FGC511
FGC511
FGC5658
FGC5658
FGC5626
FGC5626
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies