Top » Catalog » G » FGC34750

$18.00

FGC34750
[FGC34750]

FGC34750
hg38 Position: ChrY:8081160..8081160
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: G2a2a1a1c~
Comments: Below FGC6669
Forward Primer: FGC34750_F AGCAGGGACAAGGCAGGG
Reverse Primer: FGC34750_R GGATATTATCACATATCTCTGGGCAC
Reviews

Customers who bought this product also purchased
FGC6628
FGC6628
FGC6669
FGC6669
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32391
$18.00
Haplogroup Info
Other products
Currencies