Top » Catalog » G » FGC31712

$18.00

FGC31712
[FGC31712]

FGC31712
hg38 Position: ChrY:7120799..7120799
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a (not listed)
Comments: .
Forward Primer: FGC31712_F CTCCTTTCCCCCAAAGTCAC
Reverse Primer: FGC31712_R CAAGCAAAAGTGGGCTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC7360
$18.00
Haplogroup Info
Other products
Currencies