Top » Catalog » G » FGC706

$18.00

FGC706
[FGC706]

FGC706
hg38 Position: ChrY:12163451..12163451
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1 (not listed)
Comments: .
Forward Primer: FGC706_F AGACCTCACTTCCAAAGGTCAC
Reverse Primer: FGC706_R GCTGAATCTGCCAGTTACTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies