Top » Catalog » G » FGC710

$18.00

FGC710
[FGC710]

FGC710
hg38 Position: ChrY:12560395..12560395
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1 (not listed)
Comments: .
Forward Primer: FGC710_F AGTGAGTAAGTCGAGGCCTCAG
Reverse Primer: FGC710_R TATTCACCATTCTCGACTACTCATAAATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x M3562
$18.00
Haplogroup Info
Other products
Currencies