Top » Catalog » G » FGC728

$18.00

FGC728
[FGC728]

FGC728
hg38 Position: ChrY:15264089..15264089
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1 (not listed)
Comments: .
Forward Primer: FGC728_F CACTATGCTGAGGCAATCACTG
Reverse Primer: FGC728_R CCCTCCCTCATAAGGGTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x GG5
1 x FGC7282
1 x FGC495
1 x M3315
$72.00
Haplogroup Info
Other products
Currencies