Top » Catalog » G » FGC7347

$18.00

FGC7347
[FGC7347]

FGC7347
hg38 Position: ChrY:19570039..19570039
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2b1a (not listed)
Comments: Found in the Van Beurden sample
Forward Primer: FGC7347_F TTGCTCCTTTATAGTTTTGCACTC
Reverse Primer: FGC7347_R ACACATCCAAGAAGCTCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC12158
1 x GG313
$36.00
Haplogroup Info
Other products
Currencies