Top » Catalog » G » FGC510

$18.00

FGC510
[FGC510]

FGC510
hg38 Position: ChrY:19625735..19625735
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2a1a1b1a3a1~
Comments: Downstream of L140
Forward Primer: FGC510_F ATGCCTCCAGCGTTGTTG
Reverse Primer: FGC510_R CAAAAATCACAAGCTTTTCTATACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY92093
1 x BY28089
1 x GG100
1 x M3474
$72.00
Haplogroup Info
Other products
Currencies