Top » Catalog » G » FGC500

$18.00

FGC500
[FGC500]

FGC500
hg38 Position: ChrY:14276214..14276214
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2a1a1b1a3a
Comments: .
Forward Primer: FGC500_F AAGTAACACTCTGATTTCTCTCAAAGG
Reverse Primer: FGC500_R TAGTGGCAAAATATCGGCTTG
Reviews

Customers who bought this product also purchased
FGC499
FGC499
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32391
1 x FGC511
$36.00
Haplogroup Info
Other products
Currencies