Top » Catalog » G » L1259

$18.00

L1259
[L1259]

L1259
hg38 Position: ChrY:13503460..13503460
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2
Comments: Found in a hg G-U1 WTY participant
Forward Primer: L1259_F GCACTCTCCAGATTCAAGCTTC
Reverse Primer: L1259_R GAAGCTGGAATGGCAAGTG
Reviews

Customers who bought this product also purchased
P126
P126
Z30642
Z30642
M96
M96
L42
L42
Y11076
Y11076
Z1823
Z1823
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32391
1 x FGC511
$36.00
Haplogroup Info
Other products
Currencies