Top » Catalog » G » L1264

$18.00

L1264
[L1264]

L1264
hg38 Position: ChrY:7776327..7776327
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1a1a2a
Comments: Found in a hg G-U1 WTY participant
Forward Primer: L1264_F AAAATGTTAAAGTATTTCCAGACTTTGG
Reverse Primer: L1264_R GCATATCTTTAGGGCCATCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1294
1 x BY22262
$36.00
Haplogroup Info
Other products
Currencies