Top » Catalog » G » FGC3768

$18.00

FGC3768
[FGC3768]

FGC3768
hg38 Position: ChrY:8550476..8550476
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a1a1a1a1a
Comments: Below Z7940
Forward Primer: FGC3768_F GGCTCAATGATTTCCACACTG
Reverse Primer: FGC3768_R TGGTTTCCAAGCAATGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC31724
1 x BY22287
1 x F3940
1 x CTS4304
1 x BY56242
1 x FGC60019
$108.00
Haplogroup Info
Other products
Currencies