Top » Catalog » G » FGC1123

$18.00

FGC1123
[FGC1123]

FGC1123
hg38 Position: ChrY:12252333..12252333
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a1a2a
Comments: .
Forward Primer: FGC1123_F GATCTTAAATGCATTCCTTGGA
Reverse Primer: FGC1123_R CAATGCTGGGAGGGTCTG
Reviews

Customers who bought this product also purchased
FGC1147
FGC1147
FGC1137
FGC1137
FGC1132
FGC1132
FGC1126
FGC1126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies