Top » Catalog » G » FGC31719

$18.00

FGC31719
[FGC31719]

FGC31719
hg38 Position: ChrY:15074930..15074930
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a (not listed)
Comments: .
Forward Primer: FGC31719_F GGATTCTCCACTGGAGCCTC
Reverse Primer: FGC31719_R CTTTATTGTCTTGTCTTCATGGAGG
Reviews

Customers who bought this product also purchased
FGC31716
FGC31716
FGC31724
FGC31724
FGC31708
FGC31708
FGC31723
FGC31723
FGC31722
FGC31722
FGC31721
FGC31721
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies