Top » Catalog » G » FGC31722

$18.00

FGC31722
[FGC31722]

FGC31722
hg38 Position: ChrY:20956910..20956910
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G2a (not listed)
Comments: .
Forward Primer: FGC31722_F GAGGGACACTGGTACTTATCTTGC
Reverse Primer: FGC31722_R CTTTGAATGTTGGTCCAGGAG
Reviews

Customers who bought this product also purchased
FGC31708
FGC31708
FGC31723
FGC31723
FGC31721
FGC31721
FGC31720
FGC31720
FGC31719
FGC31719
FGC31716
FGC31716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies