Top » Catalog » G » CTS342

$18.00

CTS342
[CTS342]

CTS342
hg38 Position: ChrY:6832130..6832130
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b2a1a1c
Comments: Syn. with CTS11388; downstream PF3346
Forward Primer: CTS342_F TGTGCCTGAAAGTCCAATCTC
Reverse Primer: CTS342_R GCACCACAAAATACCTCAATGG
Reviews

Customers who bought this product also purchased
Z6028
Z6028
PF3180
PF3180
Y370
Y370
Y18938
Y18938
PF3346
PF3346
Z39263
Z39263
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies