Top » Catalog » G » CTS11876

$18.00

CTS11876
[CTS11876]

CTS11876
hg38 Position: ChrY:21169587..21169587
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b1a1a6~
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS11876_F TCAATCTAAGTGCCAATCAACAC
Reverse Primer: CTS11876_R TCAGGCCTCTGTTTACATTCC
Reviews

Customers who bought this product also purchased
L136
L136
Z2217
Z2217
ZS6603
ZS6603
YSC0000076
YSC0000076
FGC6064
FGC6064
L858
L858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies