Top » Catalog » G » CTS11876

$18.00

CTS11876
[CTS11876]

CTS11876
hg38 Position: ChrY:21169587..21169587
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: G2a2b1a1a6~
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS11876_F TCAATCTAAGTGCCAATCAACAC
Reverse Primer: CTS11876_R TCAGGCCTCTGTTTACATTCC
Reviews

Customers who bought this product also purchased
L858
L858
CTS9108
CTS9108
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Z2345
Z2345
L136
L136
Z2217
Z2217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies