Top » Catalog » G » FGC41452

$18.00

FGC41452
[FGC41452]

FGC41452
hg38 Position: ChrY:7507954..7507954
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC41452_F CCAAAATGACTTCAATATCGCC
Reverse Primer: FGC41452_R ACTCAACAGTGCTGCAAAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies