Top » Catalog » G » FGC7262

$18.00

FGC7262
[FGC7262]

FGC7262
hg38 Position: ChrY:2888263..2888263
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2b1a2a1b~
Comments: Found in the Van Beurden sample
Forward Primer: FGC7262_F AGCCTTATGCTGGGTGATTG
Reverse Primer: FGC7262_R TCCAGTATCCCTCTGGCAAC
Reviews

Customers who bought this product also purchased
FGC7337
FGC7337
FGC7305
FGC7305
FGC7282
FGC7282
F807
F807
FGC7284
FGC7284
FGC7283
FGC7283
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies