Top » Catalog » G » FGC7283

$18.00

FGC7283
[FGC7283]

FGC7283
hg38 Position: ChrY:7315682..7315682
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2b1a2a1b~
Comments: Found in the Van Beurden sample
Forward Primer: FGC7283_F CCAGGTAACCTCCCGCATAC
Reverse Primer: FGC7283_R AGACCCAAGATCACCACTGC
Reviews

Customers who bought this product also purchased
FGC7262
FGC7262
F807
F807
FGC7284
FGC7284
FGC7282
FGC7282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC249
1 x FGC7362
1 x BY1218
1 x FGC32413
1 x FGC1153
$90.00
Haplogroup Info
Other products
Currencies