Top » Catalog » G » FGC52591

$18.00

FGC52591
[FGC52591]

FGC52591
hg38 Position: ChrY:2857573..2857573
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: G2
Comments: .
Forward Primer: FGC52591_F TTGACTCTTTTGGGTGGTGTC
Reverse Primer: FGC52591_R AGGAAATACTGGCCAAGTGC
Reviews

Customers who bought this product also purchased
FGC52604
FGC52604
FGC52601
FGC52601
FGC52592
FGC52592
FGC41973
FGC41973
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1294
1 x BY22262
$36.00
Haplogroup Info
Other products
Currencies