Top » Catalog » G » A12435

$18.00

A12435
[A12435]

A12435
HG19 Position: ChrY:8942042..8942042
Ancestral: G
Derived: A
Reference: Rolf Langland (2016)
ISOGG Haplogroup: G
Comments: .
Forward Primer: A12435_F TGTATTGAAATCAGGCAAATCC
Reverse Primer: A12435_R GTCAGCATCATGCAATATACTTTCTAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies